Wady genetyczne i charakterystyka kliniczna pacjentów z postacią okorubocznego bielactwa (zespół Hermanskyego-Pudlaka) ad

Niektórzy z portorykańskich pacjentów nie mogli podróżować do Narodowego Centrum Zdrowia w klinice z powodu ciężkiej choroby płuc. Wcześniej opisywaliśmy 2 pacjentów z Puerto Rico15; aż 19 innych zostało zidentyfikowanych przez nieżyjącego już dr Carl Witkop i można je było opisać wcześniej.4,6,9 Protokół został zatwierdzony przez instytucjonalną komisję przeglądową Narodowego Instytutu Zdrowia Dziecka i Rozwoju Człowieka, a wszyscy pacjenci lub ich rodzice wyrazili pisemną świadomą zgodę.
Oceny kliniczne i laboratoryjne
Najlepszą skorygowaną ostrość wzroku pacjentów w wieku sześciu lat lub starszych zmierzono za pomocą wykresu Retinopathy wczesnej fazy leczenia cukrzycy i zarejestrowano jako odpowiednik Snellena. Wykonano zdjęcia przezroczystego dna oka i tęczówki u każdego pacjenta w celu wykazania stopnia pigmentacji.
Czynność kłębkową oceniano według równania Schwartza i wsp. 16: 0,55 x wysokość (w centymetrach) ÷ stężenie kreatyniny w surowicy (w miligramach na decylitr) = klirens kreatyniny (w mililitrach na minutę na 1,73 m2). Próbki moczu również otrzymano od 45 pacjentów, a wartości klirensu obliczone na podstawie stężenia w moczu i kreatyniny w surowicy potwierdziły wyniki obliczone za pomocą tego równania.
Nerkową dysfunkcję określono ilościowo za pomocą wskaźnika zespołu Fanconiego. W tym indeksie dzienne wydalanie z moczem 21 aminokwasów jest mierzone za pomocą chromatografii jonowymiennej17 i wyrażane jako mikromole na kilogram masy ciała na dzień. Im większy indeks, tym poważniejszy jest defekt w reabsorpcji rurowej. Do obliczenia wskaźnika wykorzystano co najmniej dwie 24-godzinne zbiórki moczu o rozsądnych objętościach. Lipidy w osoczu badano za pomocą systemu odczynników Gilchem (Gilford Diagnostics, Cleveland) we krwi uzyskanej od pacjentów po całonocnym skoku.17
Badania molekularne
Aby ocenić próbki dla duplikacji 16-bp, DNA ekstrahowano z limfocytów.18 Fragment 269-bp obejmujący ekson 15 HPS amplifikowano przez reakcję łańcuchową polimerazy (PCR) w 50 .l mieszaniny reakcyjnej zawierającej 50 mM chlorek potasu, 1,5 mM chlorku magnezu, 5 mM TRIS (pH 8,3), 200 mM każdego trifosforanu deoksynukleozydu, 0,01% żelatyny, 0,6 mM starterów (5. GATGGTCCACAAAGGACGAG3 . i 5. GCGTGAAGGAAGTACGGGCC3 .), 2,5 U polimerazy Taq i 500 ng matrycowego DNA. Po początkowym okresie denaturacji w 94 ° C przez 2 minuty przeprowadzono amplifikację przez 30 cykli składających się z minuty denaturacji w 94 ° C, 30 sekund wyżarzania w 60 ° C, minutę wydłużania w 72 ° C, i końcowy 10-minutowy okres wydłużenia przy 72 ° C. Produkty PCR poddano elektroforezie na 2% żelu agarozowym i wybarwiono bromkiem etydyny.
Analiza statystyczna
Do analizy danych użyto testu t-Studenta z dwustronnymi wartościami P, dokładnym testem Fishera z rozkładem chi-kwadrat i testem rang Wilcoxona.19
Wyniki
Duplikacja o wielkości 16 bp
Figura 1. Figura 1. Reprezentatywny żel agarozowy pokazujący duplikację 16 bp w eksonie 15 HPS. Amplifikacja PCR dała normalny fragment 269-bp w kontrolnym DNA od osobnika, który nie miał zespołu Hermansky ego-Pudlaka (ścieżka 2) i od dwóch pacjentów z zespołem, ale bez duplikacji 16-bp (ścieżki 5 i 6)
[podobne: dabrafenib, chloramfenikol, zielony jęczmień zastosowanieflexagen ]
[patrz też: zielony jęczmień działanie, zielony jęczmień gdzie kupić, zielony jęczmień zastosowanie ]