Identyfikacja płodowego DNA i komórek w zmianach skórnych u kobiet chorych na twardzinę układową ad

DNA pobrano również z próbek biopsyjnych aktywnych zmian skórnych od 19 kobiet, które miały stwardnienie układowe przez 18 miesięcy lub krócej, oraz z komórek krwi obwodowej u 2 z tych kobiet. Szesnaście z 19 kobiet z twardziną układową było w ciąży przed wystąpieniem choroby. Jako próbki kontrolne, DNA zostało pobrane z próbek skóry z biopsji 7 kobiet z chorobą zwyrodnieniową stawów i 61 krewnych płci żeńskiej z tych 7 kobiet (które były przedmiotem innego badania), z czego 29 procent było mężczyznami płci męskiej, a 15 procent z nich było wiadomo, że miała kobiety płci żeńskiej (31 procent było nieródkami, ale historia ciąży pozostałych nie była znana). Wyciągnęliśmy również DNA z próbek biopsyjnych skóry i powięzi z aktywnych zmian dziewięciu kobiet z zespołem mielobiny eozynofilii i dwóch kobiet z eozynofilowym zapaleniem powięzi oraz z próbki biopsji mięśniowej od jednej kobiety z zapaleniem wielomięśniowym. Jedna z tych 12 kobiet miała wiele ciąż; historie pozostałych nie były znane.
Rozpoznanie twardziny układowej zostało ustalone zgodnie z kryteriami American College of Rheumatology (wcześniej znanym jako American Rheumatism Association). Wszystkie kobiety uczestniczyły w ośrodku twardzinowym szpitala uniwersyteckiego Thomasa Jeffersona w latach 1987-1997. Średni wiek kobiety z twardziną układową wynosiły 53 lata (zakres, od 20 do 86), a średni wiek osób zdrowych i pacjentów w grupie kontrolnej wynosił 49 lat (zakres od 25 do 75). Protokół badania został zatwierdzony przez instytutowy organ weryfikacyjny Uniwersytetu Thomasa Jeffersona i uzyskano świadomą zgodę wszystkich osób.
Analiza reakcji łańcuchowej polimerazy na komórki dodatnie pod kątem Y-chromosomu
Specyficzną sekwencję chromosomu Y wykrywano przez amplifikację DNA w reakcji łańcuchowej polimerazy (PCR) ze starterami Y1-1 i Y1-2, jak opisano poprzednio.32 Pierwszą amplifikację przeprowadzono za pomocą starterów Y1-1 i Y1-2, a druga amplifikacja została wykonana za pomocą starterów zaprojektowanych przez nasze laboratorium; były to Y1-3, które ma sekwencję 5 CAGGCCTGTCCATTACACTACA3 i Y1-4, która ma sekwencję 5 GAATGGGAACGAATGGAGTGAA3 . Przeprowadzono sześćdziesiąt cykli amplifikacji w obecności 10% dimetylosulfotlenku i 10 U polimerazy Taq (Perkin-Elmer Cetus, Foster City, CA) w termocyklerze Rapidcycler PCR (Idaho Technologies, Idaho Falls, Idaho). Warunki amplifikacji to denaturacja w 94 ° C (pięć sekund), hybrydyzacja w 60 ° C (dwie sekundy) i wydłużanie w 72 ° C (pięć sekund) przez 20 cykli, a następnie 40 cykli denaturacji w temperaturze 94 ° C ( pięć sekund), wyżarzanie w 54 ° C (dwie sekundy) i wydłużanie w 72 ° C (pięć sekund). Wszystkie analizy PCR zawierały ślepą próbę (bez DNA) dla kontroli negatywnej i znaną pozytywną próbkę dla sekwencji Y (męski DNA). Powstały fragment o długości 148 pz dla chromosomu Y zidentyfikowano przez barwienie bromkiem etydyny po elektroforezie na 1,5% żelu agarozowym.
Analiza sekwencji produktu amplifikowanego PCR
Produkt PCR o długości 148 par zasad sekwencjonowano w celu potwierdzenia jego tożsamości. Fragment wklonowano do wektora klonującego TA (Clontech, Palo Alto, CA) i zsekwencjonowano za pomocą starterów do przodu i do tyłu M13.
[podobne: amiodaron, ceftriakson, Corsodyl ]
[podobne: zielony jęczmień działanie, zielony jęczmień gdzie kupić, zielony jęczmień zastosowanie ]